|
Marker Overview
Name | SSR19 |
Genbank ID | N/A |
Type | SSR |
Species | Lens culinaris |
Repeat Motif | (TG)14 |
Primer 1 | SSR19.Forward Primer: GACTCATACTTTGTTCTTAGCAG |
Primer 2 | SSR19.Reverse Primer: GAACGGAGCGGTCACATTAG |
Product Length | 250 |
Max Length | 276 |
Publication | [view all] |
Contact | Michael Baum Abhishek Bohra
|
Publications
Year | Publication |
2005 | Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77. |
2016 | Idrissi O, Udupa M, De Keyser E, Van Damme P, De Riek J. Functional Genetic Diversity Analysis and Identification of Associated Simple Sequence Repeats and Amplified Fragment Length Polymorphism Markers to Drought Tolerance in Lentil (Lens culinaris ssp. culinaris Medicus) Landraces. Plant Molecular Biology Reporter. 2016; 2016(34):659-680. |
2017 | Jha R, Bohra A, Jha UC, Rana M, Chahota RK, Kumar S, Sharma TR. Analysis of an intraspecific RIL population uncovers genomic segments harbouring multiple QTL for seed relevant traits in lentil (Lens culinaris L.). Physiology and molecular biology of plants : an international journal of functional plant biology. 2017 Jul; 23(3):675-684. |
|