|
Marker Overview
Name | SSR90 |
Genbank ID | N/A |
Type | SSR |
Species | Lens culinaris |
Repeat Motif | (TG)11(AG)10 |
Primer 1 | SSR90.Forward Primer: CCGTGTACACCCCTAC |
Primer 2 | SSR90.Reverse Primer: CGTCTTAAAGAGAGTGACAC |
Product Length | 181 |
Publication | [view all] |
Contact | Michael Baum Abhishek Bohra
|
Publications
Year | Publication |
2009 | Hamwieh A, Udupa SM, Sarker A, Jung C, Baum M. Development of new microsatellite markers and their application in the analysis of genetic diversity in lentils. 2009; 59(1):77-86. |
2015 | Mekonnen F, Mekbib F, Kumar S, Ahmed S, Sharma TR. Molecular Diversity and Population Structure of the Ethiopian Lentil (Lens Culinaris Medikus) Genotype Assessment Using SSR Markers. Journal of Crop Science and Biotechnology. 2015; 19(1):1-15. |
2017 | Jha R, Bohra A, Jha UC, Rana M, Chahota RK, Kumar S, Sharma TR. Analysis of an intraspecific RIL population uncovers genomic segments harbouring multiple QTL for seed relevant traits in lentil (Lens culinaris L.). Physiology and molecular biology of plants : an international journal of functional plant biology. 2017 Jul; 23(3):675-684. |
|