|
|
Marker Overview
| Name | Lup096 |
|---|
| Genbank ID | CA410847 |
|---|
| Type | genetic marker |
|---|
| Species | Vicia faba |
|---|
| Primer 1 | Lup096.Forward: TTGTCTCTGGTAATTCTCACAC |
|---|
| Primer 2 | Lup096.Forward Primer: TTGTCTCTGGTAATTCTCACAC |
|---|
| Primer 3 | Lup096.Reverse: AGACATGTATGACACCTGATTG |
|---|
| Primer 4 | Lup096.Reverse Primer: AGACATGTATGACACCTGATTG |
|---|
| Publication | [view all] |
|---|
| Contact | Simon Ellwood
|
|---|
| Comment | Glucose-6-P/phosphate translocator |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | CA410847 |
Publications
| Year | Publication |
|---|
| 2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
| 2006 | Nelson, MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Hane J, Williams A, O'Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones MGK, Bellgard M, Ksiazkiewicz M, Wolko B, Barker SJ, Oliver RP, Cowling WA. The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula. Theor Appl Genet. 2006; 113:225-238. |
|
