|
Marker Overview
Name | PLC96 |
Genbank ID | N/A |
Type | SSR |
Species | Lens culinaris |
Repeat Motif | (CAC)7 |
Primer 1 | PLC96.Forward Primer: TTCATCGTCGTTAATCGGAAC |
Primer 2 | PLC96.Reverse Primer: GAGAGGAAGGACATTGGAAGAA |
Publication | [view all] |
Contact | Harsh Dikshit
|
Alignments
The following features are aligned
Publications
Year | Publication |
2016 | Singh A, Dikshit HK, Singh D, Jain N, Aski M, Sarker A, Sharma TR. Use of expressed sequence tag microsatellite markers for exploring genetic diversity in lentil and related wild species. 2016; 1-16. |
2017 | Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296. |
|