Ca-CNMS59, Ca-CNMS59 () Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	Ca-CNMS59
Genbank ID	28367313
Type	SSR
Species	Cicer sp.
Repeat Motif	(ATC)6
Primer 1	Ca-CNMS59.Forward primer: CATATATCCAAGGTGTGGTTG
Primer 2	Ca-CNMS59.Reverse primer: GTGGTCCAGTGATAATGTTGT
Product Length	150
Publication	[view all]
Contact	Swarup K. Parida

Contact

Name

Details

Swarup K. Parida

First name:	Swarup
Last name:	Parida
Institution:	National Institute of Plant Genome Research
Address:	Aruna Asaf Ali Marg, New Delhi 110067, India
Country:	India
Email:	swarup@nipgr.ac.in
Last update:	Apr 2018

References

External references for this genetic_marker


Database	Accession
DB:genbank	28367313

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold1348_1	supercontig	scaffold1348_1:43879..44028 .
scaffold1348_1	chromosome	scaffold1348_1:43879..44028 .

Publications


Year	Publication
2014	Bajaj D, Saxena MS, Kujur A, Das S, Badoni S, Tripathi S, Upadhyaya HD, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide conserved non-coding microsatellite (CNMS) marker-based integrative genetical genomics for quantitative dissection of seed weight in chickpea. Journal of experimental botany. 2014 Dec 10.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xICC17163-RIL	LG1	N/A	92.1	Ca-CNMS59	View