BM-157

Name	BM-157
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(GA)16
Primer 1	BM-157.Forward: ACTTAACAAGGAATAGCCACACA
Primer 2	BM-157.Reverse: GTTAATTGTTTCCAATATCAACCTG
Product Length	113
Publication	[view all]
Contact	J. Tohme

Name	Details
J. Tohme	First name: J Last name: Tohme Institution: International Center for Tropical Agriculture Email: j.tohme@cgiar.org Last update: Nov 2002

Feature Name	Type	Location	Analysis	Reference
Chr10	supercontig	Chr10:10005813..10005925 .	Phaseolus vulgaris G19833 genome v2.1	PCD marker alignment to genome using primer sequences
Vu10	supercontig	Vu10:438390..438501 .	Vigna unguiculata L. Walp IT97K-499-35 genome v1.1	PCD marker alignment to genome using primer sequences
Scaffold133612-KQ483928.1	supercontig	Scaffold133612-KQ483928.1:71952..72053 .	Cajanus cajan Asha genome v1.0	PCD marker alignment to genome using primer sequences
chr09	chromosome	chr09:7690884..7691003 .	Vigna radiata cv. VC1973A genome v6.0	PCD marker alignment to genome using primer sequences
Chr_11-CM003381.1	supercontig	Chr_11-CM003381.1:25972119..25972249 .	Vigna angularis Jingnong 6 genome v1.1	PCD marker alignment to genome using primer sequences

Year	Publication
2002	Gaitan-Solis E, Duque MC, Edwards KJ, Tohme J. Microsatellite Repeats in Common Bean (Phaseolus vulgaris): Isolation, Characterization, and Cross-Species Amplification in Phaseolus ssp.. Crop Science. 2002; 42:2128-2136.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-CAL143/IAC-UNA-RIL	LG10	N/A	100.3	BM157	View
2	Vigna-JP235863/AusTRCF66514-F2	LG09	N/A	0	BM157	View
3	Vigna-TN67/ICPMO_056-F2	LG09	N/A	0	BM157	View
4	Bean-Tiber/Starozagorski-Integrated	LG10	N/A	52.27	BM157	View
5	Bean-Tiber/Starozagorski-RIL	LG10	N/A	59.68	BM157	View
6	Mungbean-JP211874/JP229096-BC1F1	LG9	N/A	0	BM157	View
7	Vigna-IPCMO056/TN67-F2	LG09	N/A	0	BM157	View