|
Marker Overview
Name | PvM-014 |
Genbank ID | N/A |
Type | SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (AATC)5 |
Primer 1 | PvM-014.Forward: AAAGCCACAAAAACCATAAACC |
Primer 2 | PvM-014.Reverse: GCCTCCGAAAGATTCAACG |
Product Length | 204 |
Publication | [view all] |
Contact | Maria Vieira
|
Publications
Year | Publication |
2007 | Hanai LR, de Campos T, Camargo LE, Benchimol LL, de Souza AP, Melotto M, Carbonell SA, Chioratto AF, Consoli L, Formighieri EF, Siqueira MV, Tsai SM, Vieira ML. Development, characterization, and comparative analysis of polymorphism at common bean SSR loci isolated from genic and genomic sources. Genome. 2007 Mar; 50(3):266-77. |
|