CaSTMS28, CaSTMS28 (genetic_marker) Cicer arietinum

Marker Overview
NameCaSTMS28
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motiflong imperfect ATT repeat
Primer 1CaSTMS28.Forward primer: CCCTTCTAGTGATATTTTG
Primer 2CaSTMS28.Reverse primer: AAATGTGTTTTATGGAATAAGTCAT
Product Length259
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerCaSTMS28.Forward primerCicer arietinumprimer
Reverse primerCaSTMS28.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICC12004xLasseter.LG1.field.IDSCicer arietinumQTL
Ascochyta blight resistanceqABR.ICC12004xLasseter.LG1.field.AUDCPCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Beta-carotene contentqBCARC.HadasxCr205.LG3BCicer sp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CaSTMS28CaSTMS28Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG3N/A71.6CaSTMS28View
2chickpea-ICCV96029xAmit-F2LG3N/A95.2CaSTMS28View
3chickpea-ICCV96029xCDCCorinne-F2LG3N/A94.1CaSTMS28View
4chickpea-ICCV96029xCDCFrontier-F2LG3N/A131.9CaSTMS28View
5chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A85.4CaSTMS28View
6chickpea-ICC4958xPI489777-RIL-F10LG3N/A17.24CaSTMS28View
7chickpea-ICCV96029xCDCFrontier-F2-2007LG3N/A131.9CaSTMS28View
8chickpea-HadasxCr205-F2LG3BN/A0CaSTMS28View
9chickpea-ICC4958xPI489777-RIL-F10-2012LG03N/A36.85CaSTMS28View
10chickpea-ICC12004xLasseter-F2LGIN/A190.2CaSTMS28View
11chickpea-LasseterxICC3996-F6-RILLG3N/A0CaSTMS28View
12chickpea-S95362xHowzat-F6-RILLG3N/A3.7CaSTMS28View
13chickpea-ICC4958xPI489777-RIL-2010LG3N/A59.9CaSTMS28View