TS43, TS43 (genetic_marker) Cicer arietinum

Marker Overview
NameTS43
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(ATT)33
Primer 1TS43.Forward primer: AAGTTTGGTCATAACACACATTCAATA
Primer 2TS43.Reverse primer: TAAATTCACAAACTCAATTTATTGGC
Product Length212
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TS43.Forward primerTS43.Forward primerCicer arietinumprimer
TS43.Reverse primerTS43.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed colorSDCL.ICC3996xS95362.LG5.H.CIE_aCicer arietinumQTL
Seed colorSDCL.ICC3996xS95362.LG5.M.CIE_aCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ILC588xILC3279.LG3.TH-Dr10Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TS43TS43Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG5BN/A46TS43View
2chickpea-C214xWR315-F2LG5N/A60.8TS43View
3chickpea-ICC4991xICCV04516-F2LG5BN/A0TS43View
4chickpea-ICCV2xJG62-RILLG7N/A1.7TS43View
5chickpea-ICCV96029xCDCFrontier-F2LG5N/A40.1TS43View
6chickpea-ILC588xILC3279-RILLG3N/A19.7TS43View
7chickpea-JG62xVijay-RIL-2011LG1N/A113.2TS43View
8chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A50.4TS43View
9chickpea-VijayxICC4958-RIL-2011LG1aN/A89.9TS43View
10chickpea-ICC4958xPI489777-RIL-2012LG5N/A204.1TS43View
11chickpea-ICCV2xJG62-RIL-F10-2011LGVN/A40.8TS43View
12chickpea-ICC4958xPI489777-RIL-F10LG5N/A86.96TS43View
13chickpea-ICCV96029xCDCFrontier-F2-2007LG5N/A40.1TS43View
14chickpea-ICC4958xPI489777-RIL-F10-2012LG05N/A79.85TS43View
15chickpea-ICC12004xLasseter-F2LGVIIN/A8TS43View
16chickpea-ICC3996xILWC184-F2LG5N/A11.6TS43View
17chickpea-ICC4958xPI489777-RIL-2010LG5N/A147TS43View
18chickpea-ICC4958xPI489777-RIL-2015-2LG5N/A48.53TS43View
19Chickpea-JG62xVijayxVijayxICC4958-RILLG1 (LGIII+V+XIII)N/A50.4TS43View
20Chickpea-CA2156_x_JG62-RILRIP-1 LG5N/A22.7TS43View
21Chickpea-ILC3279_x_JG62-RILRIP-7 LG5N/A8.4TS43View
22Chickpea-JG62_x_ILC72-RILRIP-10 LG5N/A19.7TS43View
23Chickpea-Physical_consensusCa5N/A17947993TS43View
24Chickpea-ICCL81001_x_Cr5-9-RILLG5N/A88.8TS43View
25Chickpea_SBD377_X_BGD112_RILLG5N/A128.9TS43View
26Chickpea-RIP12-OrtegaLG05N/A3.5TS43View
27Chickpea-RIP8-OrtegaLG05N/A0.7TS43View
28Chickpea-SBD377/BGD112-RIL-High_densityLG05N/A65.43TS43View