AA303, AA303 (genetic_marker) Pisum sativum

Marker Overview
NameAA303
AliasPSMPSAA303
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA303.Forward Primer: gggtgaaggaaaatcgtga
Primer 2AA303.Reverse Primer: gcatcccataaaattggttct
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA303.Forward PrimerPisum sativumprimer
Reverse PrimerAA303.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA303AA303Pisum sativummarker_locus
PSMPSAA303PSMPSAA303Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG2N/A58.2AA303View
2pea-consensusMap-2011LGIIN/A58.9AA303View
3pea-KaspaxParafield-RILLGIIN/A87.4AA303View
4Pea-Integrated_Map-Sudheesh-2015LG2N/A110.61AA303View
5Pea-Composite_Map-Sudheesh-2015LG2N/A80.83AA303View
6pea-JI296xDP-RIL-2004LGIIN/A104PSMPSAA303View