AC74, AC74 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AC74
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AC74.Forward Primer: ccttagtgttcttcaactc
Primer 2	AC74.Reverse Primer: acagaaccaagttatcaata
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr5LG3	supercontig	chr5LG3:468574793..468574910 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGVI	N/A	20.9	AC74	View
2	pea-TeresexChampagne-RIL	LGVIa.2	N/A	20.3	AC74	View
3	pea-ShawneexBohatyr-RIL	LGVI.3	N/A	15	AC74	View
4	pea-consensusMap-2011	LGVI	N/A	25.4	AC74	View
5	pea-microsatComposite-2005	LGVI	N/A	16.6	AC74	View
6	Pea-Baccara/PI180693_Duarte-RIL-2016	LGVI	N/A	14.3	AC74-142	View
7	Pea-Baccara/PI180693_GBS-RIL-2016	LGVI	N/A	18.2	AC74-142	View