|
|
Marker Overview
| Name | Clpser |
|---|
| Genbank ID | AJ276507 |
|---|
| Type | Indel |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | Clpser.Forward Primer: GTATTGGAGGAGGATTTTAGGG |
|---|
| Primer 2 | Clpser.Reverse Primer: GCTTATGAGTTTGGAGGGGAGGGG |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | AJ276507 |
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
| 2016 | Ferrari B., Romani M., Aubert G., Boucherot K., Burstin J., Pecetti L., Huart-Naudet M., Klein A., Annicchiarico P. . Association of SNP Markers with Agronomic and Quality Traits of Field Pea in Italy. Czech Journal of Genetics and Plant Breeding. 2016; 52(3):83-93. |
|
