|
|
Marker Overview
| Name | PSU51918 |
|---|
| Genbank ID | U51918 |
|---|
| Type | SSR |
|---|
| Species | Pisum sativum |
|---|
| Repeat Motif | (GAA)6 |
|---|
| Primer 1 | PSU51918.Forward Primer: gtcgtaacagatcaatatggc |
|---|
| Primer 2 | PSU51918.Reverse Primer: cgatagtgagagtggcggttg |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | U51918 |
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2001 | Burstin J, Deniot G, Potier J, Weinachter C, Aubert G, Baranger A. Microsatellite polymorphism in Pisum sativum. Plant breeding = Zeitschrift für Pflanzenzüchtung. 2001 Aug; 120(4):311-317. |
| 2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
|
