Viola1, Viola1 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	Viola1
Genbank ID	CD859115
Type	SSCP
Species	Pisum sativum
Primer 1	Viola1.Forward Primer: mTTCAAACCCGTCATGTGCT
Primer 2	Viola1.Reverse Primer: GAATTCATCAACCACGCTGT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CD859115

Publications


Year	Publication
2006	Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGV	N/A	146.8	Viola1	View
2	pea-consensusMap-2011	LGV	N/A	164.9	Viola1	View
3	pea-TeresexChampagne-RIL-2008	LG5	N/A	221	Viola1	View
4	pea-TeresexChampagne-RIL-2009	LG5	N/A	221	Viola1	View
5	pea-compositeMap-2006	LGV	N/A	2.9	Viola2	View
6	pea-consensusMap-2011	LGV	N/A	0	Viola2	View