SSR317-1, SSR317-1 (genetic_marker) Lens culinaris

Marker Overview
NameSSR317-1
AliasSSR317
Genbank IDN/A
TypeSSR
SpeciesLens culinaris
Repeat Motif(AT)4(GT)16(GC)6GTGGC(GT)5A(TG)8+(TAA)5
Primer 1SSR317-1.Forward Primer: GTGGGTGTAATTATTGCTAC
Primer 2SSR317-1.Reverse Primer: GTATCAAACTTATGGTGAAATC
Product Length308
Publication[view all]
ContactMichael Baum
Harsh Dikshit
Sukhjiwan Kaur
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerSSR317-1.Forward PrimerLens culinarisprimer
Reverse PrimerSSR317-1.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SSR317-1SSR317-1Lens culinarismarker_locus
SSR317SSR317Lens culinarismarker_locus


Contact
NameDetails
Michael Baum
First name:Michael
Last name:Baum
Institution:International Centre for Agricultural Research in the Dry Areas
Address:ICARDA, PO Box 5466, Aleppo, Syria
Country:Syria
Email:M.Baum@cgiar.org
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com
Sukhjiwan Kaur
First name:Sukhjiwan
Last name:Kaur
Title:Researcher
Institution:La Trobe University
Address:Biosciences Research, Agriculture Victoria, AgriBio, La Trobe University, Bundoora, VIC, Australia
Country:Australia
Email:sukhjiwan.kaur@ecodev.vic.gov.au
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-CDC_Robin/964a-46-RIL-2017LG02N/A26.6SSR317-1View
2lentil-CassabxILL2024-F6LG4.1N/A97.3SSR317-1View
3lentil-CDCRobinx964a-46-RILLG2N/A32.4SSR317-1View
4lentil-CDCRobinx964a-46-RIL-2013LG2N/A17.5SSR317-1View
5lentil-ILL5588xL692-16-1-RILLG1N/A71.7SSR317-1View
6Lentil_Precoz_x_L830_RILLG1N/A31.9SSR317-1View
7Lentil-Consensus-RIL-2016LG2N/A257.41SSR317-1View
8lentil-ILL5588xILL5722-F5-RILLGIVN/A217.3SSR317View
9lentil-ILL5588xILL5722-F5-RIL-2012LGIXN/A7.5SSR317View
10lentil-PrecozxL830-RILLG1N/A31.9SSR317View