|
|
Marker Overview
| Name | NCPGR21 |
|---|
| Genbank ID | AY446327 |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | Pusa362 |
|---|
| Repeat Motif | (CT)15 |
|---|
| Primer 1 | NCPGR21.Forward primer: TCTACCTCGTTTTTCGTGCC |
|---|
| Primer 2 | NCPGR21.Reverse primer: TTGCTCCTTCAACAAAACCC |
|---|
| Product Length | 137 |
|---|
| Publication | [view all] |
|---|
| Contact | Vincent Vadez
|
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | AY446327 |
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2006 | Sethy NK, Shokeen B, Edwards KJ, Bhatia S. Development of microsatellite markers and analysis of intraspecific genetic variability in chickpea (Cicer arietinum L.). Theor Appl Genet. 2006; 112:1416-1428. |
| 2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
| 2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
| 2015 | Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7. |
|
