AA155, AA155 (genetic_marker) Pisum sativum

Marker Overview
NameAA155
AliasAA155_354
PSAA155
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA155.Forward Primer: catttgaatagttgcaatttca
Primer 2AA155.Reverse Primer: tatttctccaccagagttaggt
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA155.Forward PrimerPisum sativumprimer
Reverse PrimerAA155.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA155AA155Pisum sativummarker_locus
AA155_354AA155_354Pisum sativummarker_locus
PSAA155PSAA155Pisum sativummarker_locus
AA155-365AA155-365-55.1Pisum sativummarker_locus
AA155-365AA155-365-56.5Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-OrbxCDCStriker-RILLGI-1N/A41.9AA155View
2pea-consensusMap-2011LGIN/A69.6AA155View
3pea-KaspaxParafield-RILLGIN/A165.3AA155View
4Pea-Integrated_Map-Sudheesh-2015LG1N/A194.01AA155View
5Pea-Composite_Map-Sudheesh-2015LG1N/A207.6AA155View
6pea-OrbxCDCStriker-RILLGI-2N/A59.5AA155_354View
7pea-OrbxCDCStriker-RIL-2010LGI-1N/A59.5AA155_354View
8pea-DSPx90-2131-RIL-2015LGIN/A69.6PSAA155View
9Pea-Baccara/PI180693_Duarte-RIL-2016LGIN/A55.1AA155-365-55.1View
10Pea-Baccara/PI180693_GBS-RIL-2016LGIN/A56.5AA155-365-56.5View