AB33, AB33 (genetic_marker) Pisum sativum

Marker Overview
NameAB33
AliasPSMPSAB33
AB33-337
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AB33.Forward Primer: cattgaatttgtgggagaaagg
Primer 2AB33.Reverse Primer: tgtggatgttgcaatttcgt
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAB33.Forward PrimerPisum sativumprimer
Reverse PrimerAB33.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Days to 50% floweringqDFTFL.JI296xDP.LGIII.flo2Pisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AB33AB33Pisum sativummarker_locus
AB33-337AB33-337Pisum sativummarker_locus
PSMPSAB33PSMPSAB33Pisum sativummarker_locus
AB33-374AB33-374-63.2Pisum sativummarker_locus
AB33-374AB33-374-54.8Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-compositeMap-2006LGIIN/A66.4AB33View
2pea-TeresexK586-RILLGII.1N/A66.1AB33View
3pea-consensusMap-2011LGIIN/A63.7AB33View
4pea-microsatComposite-2005LGIIN/A98.3AB33View
5pea-PennantxPI595933-F2LG7aN/A263.1AB33View
6pea-KaspaxParafield-RILLGIIN/A85.9AB33View
7Pea-Integrated_Map-Sudheesh-2015LG2N/A117.16AB33View
8Pea-Composite_Map-Sudheesh-2015LG2N/A87.38AB33View
9Pea-Kaspa_x_PBA Oura-RILLG2N/A0AB33View
10pea-ShawneexBohatyr-RILLGVII.3N/A215.7AB33-337View
11pea-microsatComposite-2005LGVIIN/A179.3AB33-337View
12pea-JI296xDP-F2:6-RILLG2N/A97PSMPSAB33View
13pea-JI296xDP-RIL-2004LGIIN/A96PSMPSAB33View
14Pea-Baccara/PI180693_Duarte-RIL-2016LGIIN/A63.2AB33-374-63.2View
15pea-BaccaraxPI180693-RILLGIIN/A63.2AB33-374-63.2View
16Pea-Baccara/PI180693_GBS-RIL-2016LGIIN/A54.8AB33-374-54.8View