AB72, AB72 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB72
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB72.Forward Primer: atctcatgttcaacttgcaaccttta
Primer 2	AB72.Reverse Primer: ttcaaaacacgcaagttttctga
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr6LG2	supercontig	chr6LG2:46031317..46031700 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	29.7	AB72	View
2	pea-TeresexChampagne-RIL	LGII.2	N/A	23.1	AB72	View
3	pea-consensusMap-2011	LGII	N/A	36.1	AB72	View
4	pea-microsatComposite-2005	LGII	N/A	48.6	AB72	View
5	pea-TeresexChampagne-RIL-2009	LG2	N/A	22.4	AB72	View
6	pea-PennantxPI595933-F2	LG7	N/A	255.4	AB72	View