|
|
Marker Overview
| Name | AGO1 |
|---|
| Genbank ID | EF108450 |
|---|
| Type | HRM |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | AGO1.Forward Primer: TTACTCCCATGTCATCCTTGG |
|---|
| Primer 2 | AGO1.Reverse Primer: CAAGCATTAAAGAACCAGCAAG |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | EF108450 |
Publications
| Year | Publication |
|---|
| 2010 | Deulvot C, Charrel H, Marty A, Jacquin F, Donnadieu C, Lejeune-Hénaut I, Burstin J, Aubert G. Highly-multiplexed SNP genotyping for genetic mapping and germplasm diversity studies in pea. BMC genomics. 2010; 11:468. |
| 2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
| 2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
| 2014 | Klein A, Houtin H, Rond C, Marget P, Jacquin F, Boucherot K, Huart M, Riviere N, Boutet G, Lejeune-Henaut I, Burstin J. QTL analysis of frost damage in pea suggests different mechanisms involved in frost tolerance. Theoretical and Applied Genetics. 2014; 127(6):1319-1330. |
|
