|
|
Marker Overview
| Name | Sucsyn |
|---|
| Genbank ID | AJ012080 |
|---|
| Type | CAPS |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | Sucsyn.Forward Primer: CATGCTCTTGTGGTTGAAACTTTGC |
|---|
| Primer 2 | Sucsyn.Reverse Primer: CAATGATTATAAAAACTGAATCGATTTG |
|---|
| Restriction Enzyme | TasI |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | AJ012080 |
Publications
| Year | Publication |
|---|
| 2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
| 2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
| 2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
| 2014 | Klein A, Houtin H, Rond C, Marget P, Jacquin F, Boucherot K, Huart M, Riviere N, Boutet G, Lejeune-Henaut I, Burstin J. QTL analysis of frost damage in pea suggests different mechanisms involved in frost tolerance. Theoretical and Applied Genetics. 2014; 127(6):1319-1330. |
|
