D21, D21 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	D21
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	D21.Forward Primer: tattctcctccaaaatttcctt
Primer 2	D21.Reverse Primer: gtcaaaattagccaaattcctc
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr2LG1	supercontig	chr2LG1:393838274..393838592 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGI	N/A	154.6	D21	View
2	pea-TeresexChampagne-RIL	LGI.2	N/A	173.9	D21	View
3	pea-ShawneexBohatyr-RIL	LGIb.3	N/A	163.4	D21	View
4	pea-TeresexK586-RIL	LGIb.1	N/A	77.1	D21	View
5	pea-consensusMap-2011	LGI	N/A	119.8	D21	View
6	pea-microsatComposite-2005	LGI	N/A	134.9	D21	View
7	Pea-DDR14/Explorer-F2	LG01	N/A	12.4	D21	View
8	pea-TeresexChampagne-RIL-2009	LG1	N/A	143.5	D21	View
9	Pea-Cheyenne/ZP0104-F5-RIL	LG01-2	N/A	17.4	D21	View
10	pea-JI296xDP-RIL-2004	LGI	N/A	105	PSMPD21	View