|
Marker Overview
Name | SOD9 |
Genbank ID | CAA39819 |
Type | SSCP |
Species | Pisum sativum |
Primer 1 | SOD9.Forward Primer: hCCAATTCAGTCGTTGGGAGA |
Primer 2 | SOD9.Reverse Primer: ATCTTCCACCAGCATTTCCA |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | CAA39819 |
Publications
Year | Publication |
2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
2014 | Klein A, Houtin H, Rond C, Marget P, Jacquin F, Boucherot K, Huart M, Riviere N, Boutet G, Lejeune-Henaut I, Burstin J. QTL analysis of frost damage in pea suggests different mechanisms involved in frost tolerance. Theoretical and Applied Genetics. 2014; 127(6):1319-1330. |
2016 | Ferrari B., Romani M., Aubert G., Boucherot K., Burstin J., Pecetti L., Huart-Naudet M., Klein A., Annicchiarico P. . Association of SNP Markers with Agronomic and Quality Traits of Field Pea in Italy. Czech Journal of Genetics and Plant Breeding. 2016; 52(3):83-93. |
|