AA122, AA122 (genetic_marker) Pisum sativum

Marker Overview
NameAA122
AliasPSAA122
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA122.Forward Primer: gggtctgcataagtagaagcca
Primer 2AA122.Reverse Primer: aaggtgtttcccctagacatca
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA122.Forward PrimerPisum sativumprimer
Reverse PrimerAA122.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Aphanomyces root rot resistanceqARR.Baccarax552.LGIV.Ps4.4Pisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA122AA122Pisum sativummarker_locus
PSAA122PSAA122Pisum sativummarker_locus
AA122-212AA122-212-86Pisum sativummarker_locus
AA122-212AA122-212-79.9Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG4N/A133.3AA122View
2pea-compositeMap-2006LGIVN/A114.8AA122View
3pea-TeresexChampagne-RILLGIVb.2N/A17.9AA122View
4pea-TeresexK586-RILLGIV.1N/A103.1AA122View
5pea-consensusMap-2011LGIVN/A137.4AA122View
6pea-microsatComposite-2005LGIVN/A116.1AA122View
7pea-PennantxPI595933-F2LG7bN/A827.3AA122View
8Pea-Integrated_Map-Sudheesh-2015LG4N/A126.08AA122View
9Pea-Composite_Map-Sudheesh-2015LG4N/A121.34AA122View
10pea-DSPx90-2131-RIL-2015LGIVN/A170.2PSAA122View
11Pea-Baccara/PI180693_Duarte-RIL-2016LGIVN/A86AA122-212-86View
12Pea-Baccara/PI180693_GBS-RIL-2016LGIVN/A79.9AA122-212-79.9View