AB28, AB28 (genetic_marker) Pisum sativum

Marker Overview
NameAB28
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AB28.Forward Primer: cctgagtcatcacataggagat
Primer 2AB28.Reverse Primer: gcagaagtatttgacttgatggaa
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAB28.Forward PrimerPisum sativumprimer
Reverse PrimerAB28.Reverse PrimerPisum sativumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Pea weevil resistanceqPWR.PennantxPI595933.LG4.COR4aPisum sp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AB28AB28Pisum sativummarker_locus
PSMPSAB28PSMPSAB28Pisum sativummarker_locus
AB28AB28-44.2Pisum sativummarker_locus
AB28AB28-40.7Pisum sativummarker_locus
AB28-392AB28-392-89.4Pisum sativummarker_locus
AB28-392AB28-392-85Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-compositeMap-2006LGIN/A133.9AB28View
2pea-TeresexChampagne-RILLGI.2N/A150.9AB28View
3pea-ShawneexBohatyr-RILLGIb.3N/A136AB28View
4pea-TeresexK586-RILLGIb.1N/A64.3AB28View
5pea-consensusMap-2011LGIN/A102AB28View
6pea-microsatComposite-2005LGIN/A113.9AB28View
7pea-PennantxPI595933-F2LG4N/A21.6AB28View
8Pea-Composite_Map-RILLGIIIN/A45.4AB28View
9Pea-Integrated_Map-Sudheesh-2015LG1N/A108.95AB28View
10Pea-Composite_Map-Sudheesh-2015LG1N/A111.9AB28View
11Pea-Kaspa_x_PBA Oura-RILLG1N/A39.8AB28View
12pea-TeresexChampagne-RIL-2009LG1N/A126.1AB28View
13pea-JI296xDP-RIL-2004LGIN/A85PSMPSAB28View
14Pea-Baccara/PI180693_Duarte-RIL-2016LGIIIN/A44.2AB28View
15pea-BaccaraxPI180693-RILLGIIIN/A44.2AB28View
16Pea-Baccara/PI180693_GBS-RIL-2016LGIIIN/A40.7AB28View
17Pea-Baccara/PI180693_Duarte-RIL-2016LGIN/A89.4AB28-392View
18Pea-Baccara/PI180693_GBS-RIL-2016LGIN/A85AB28-392View