AD147, AD147 (genetic_marker) Pisum sativum

Marker Overview
NameAD147
AliasPSMPSAD147
PSAD147
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AD147.Forward Primer: agcccaagtttcttctgaatcc
Primer 2AD147.Reverse Primer: aaattcgcagagcgtttgttac
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAD147.Forward PrimerPisum sativumprimer
Reverse PrimerAD147.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AD147AD147Pisum sativummarker_locus
PSMPSAD147PSMPSAD147Pisum sativummarker_locus
PSAD147PSAD147Pisum sativummarker_locus
AD147-352AD147-352-60.6Pisum sativummarker_locus
AD147-352AD147-352-58.6Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG1N/A97.5AD147View
2pea-compositeMap-2006LGIN/A88.1AD147View
3pea-TeresexChampagne-RILLGI.2N/A70.6AD147View
4pea-ShawneexBohatyr-RILLGIb.3N/A60.3AD147View
5pea-TeresexK586-RILLGIb.1N/A13.9AD147View
6pea-consensusMap-2011LGIN/A72.5AD147View
7pea-microsatComposite-2005LGIN/A78.3AD147View
8pea-TeresexChampagne-RIL-2008LG1N/A97.5AD147View
9Pea-HUVP1_x_FC1-RILLGIN/A20AD147View
10pea-JI296xDP-RIL-2004LGIN/A57PSMPSAD147View
11pea-DSPx90-2131-RIL-2015LGIN/A92PSAD147View
12Pea-Baccara/PI180693_GBS-RIL-2016LGIN/A60.6AD147-352-60.6View
13Pea-Baccara/PI180693_Duarte-RIL-2016LGIN/A58.6AD147-352-58.6View